Stem-loop sequence cel-mir-2210

AccessionMI0010960 (change log)
DescriptionCaenorhabditis elegans miR-2210 stem-loop
Literature search

1 open access papers mention cel-mir-2210
(1 sentences)

Stem-loop
   --a  c   u     aau       u    a 
5'    gg aga caauc   uuuuagg uuau u
      || ||| |||||   ||||||| ||||  
3'    cc ucu guuag   gaaaucc aaua a
   cac  a   c     -cu       u    a 
Get sequence
Deep sequencing
519 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 10914618-10914678 [+]
intergenic
Database links

Mature sequence cel-miR-2210-5p

Accession MIMAT0011435
Previous IDscel-miR-2210
Sequence

1 - 

aggcagaucaaucaauuuuuagg

 - 23

Get sequence
Deep sequencing115 reads, 9 experiments
Evidence experimental; Illumina [1], CLIPseq [2]
Database links
Predicted targets

Mature sequence cel-miR-2210-3p

Accession MIMAT0011436
Previous IDscel-miR-2210*
Sequence

40 - 

uaaagucgauugcucuacccac

 - 61

Get sequence
Deep sequencing402 reads, 9 experiments
Evidence experimental; Illumina [1], CLIPseq [2]
Database links
Predicted targets

References

1
2
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).