Stem-loop sequence cel-mir-2209c

AccessionMI0010959 (change log)
DescriptionCaenorhabditis elegans miR-2209c stem-loop
Literature search

2 open access papers mention cel-mir-2209c
(2 sentences)

Stem-loop
   --g          cac     g     aaacu 
5'    aguguaaccg   gucuu uuuca     c
      ||||||||||   ||||| |||||      
3'    ucacauuggc   cagaa aaggu     a
   aca          cac     a     auaua 
Get sequence
Deep sequencing
63 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 1027218-1027281 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-2209c
cel-mir-2209bchrIV: 1021303-1021365 [-]
cel-mir-2208achrIV: 1021772-1021832 [+]
cel-mir-2208bchrIV: 1026580-1026640 [+]
cel-mir-2209achrIV: 1027101-1027164 [+]
cel-mir-2209cchrIV: 1027218-1027281 [+]
Database links

Mature sequence cel-miR-2209c-5p

Accession MIMAT0011433
Previous IDscel-miR-2209c*
Sequence

1 - 

gaguguaaccgcacgucuuguuu

 - 23

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2209c-3p

Accession MIMAT0011434
Previous IDscel-miR-2209c
Sequence

42 - 

aaaagaccaccgguuacacuaca

 - 64

Get sequence
Deep sequencing60 reads, 11 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1