Stem-loop sequence cel-mir-2209a

AccessionMI0010958 (change log)
DescriptionCaenorhabditis elegans miR-2209a stem-loop
Gene family MIPF0000787; mir-2209
Literature search

2 open access papers mention cel-mir-2209a
(2 sentences)

Stem-loop
   --g         a  cu    c   -   guau 
5'    aguguaacc cu  ucuc uuc cga    u
      ||||||||| ||  |||| ||| |||     
3'    ucacauugg ga  agag aag gcu    g
   aca         c  cu    -   a   auua 
Get sequence
Deep sequencing
7091 reads, 12.5 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 1027101-1027164 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-2209a
cel-mir-2209bchrIV: 1021303-1021365 [-]
cel-mir-2208achrIV: 1021772-1021832 [+]
cel-mir-2208bchrIV: 1026580-1026640 [+]
cel-mir-2209achrIV: 1027101-1027164 [+]
cel-mir-2209cchrIV: 1027218-1027281 [+]
Database links

Mature sequence cel-miR-2209a-5p

Accession MIMAT0011431
Previous IDscel-miR-2209a*
Sequence

1 - 

gaguguaaccacucuucuccuuc

 - 23

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence cel-miR-2209a-3p

Accession MIMAT0011432
Previous IDscel-miR-2209a
Sequence

43 - 

agagaucagcgguuacacuaca

 - 64

Get sequence
Deep sequencing7083 reads, 16 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1