Stem-loop sequence cel-mir-2208b

AccessionMI0010957 (change log)
DescriptionCaenorhabditis elegans miR-2208b stem-loop
Gene family MIPF0000772; mir-2208
Literature search

1 open access papers mention cel-mir-2208b
(1 sentences)

Stem-loop
   --         cg      a      aucac 
5'   aaguguacc  gaucug uauccu     c
     |||||||||  |||||| ||||||      
3'   uucacaugg  uuagac guagga     a
   ac         uu      -      gaaaa 
Get sequence
Deep sequencing
760 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 1026580-1026640 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-2208b
cel-mir-2209bchrIV: 1021303-1021365 [-]
cel-mir-2208achrIV: 1021772-1021832 [+]
cel-mir-2208bchrIV: 1026580-1026640 [+]
cel-mir-2209achrIV: 1027101-1027164 [+]
cel-mir-2209cchrIV: 1027218-1027281 [+]
Database links

Mature sequence cel-miR-2208b-5p

Accession MIMAT0011429
Sequence

1 - 

aaguguacccggaucugauaucc

 - 23

Get sequence
Deep sequencing336 reads, 11 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence cel-miR-2208b-3p

Accession MIMAT0011430
Sequence

40 - 

augcagauuuugguacacuuca

 - 61

Get sequence
Deep sequencing422 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1