Stem-loop sequence cel-mir-2208a

AccessionMI0010956 (change log)
DescriptionCaenorhabditis elegans miR-2208a stem-loop
Gene family MIPF0000772; mir-2208
Stem-loop
   --         c   u   a      --a  a 
5'   aaguguacc gaa cug uauccu   uc u
     ||||||||| ||| ||| ||||||   ||  
3'   uucauaugg cuu gac guagga   ag c
   ac         u   u   -      aaa  u 
Get sequence
Deep sequencing
329 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 1021772-1021832 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-2208a
cel-mir-2209bchrIV: 1021303-1021365 [-]
cel-mir-2208achrIV: 1021772-1021832 [+]
cel-mir-2208bchrIV: 1026580-1026640 [+]
cel-mir-2209achrIV: 1027101-1027164 [+]
cel-mir-2209cchrIV: 1027218-1027281 [+]
Database links

Mature sequence cel-miR-2208a-5p

Accession MIMAT0011427
Previous IDscel-miR-2208a
Sequence

1 - 

aaguguacccgaaucugauaucc

 - 23

Get sequence
Deep sequencing315 reads, 11 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence cel-miR-2208a-3p

Accession MIMAT0011428
Previous IDscel-miR-2208a*
Sequence

40 - 

augcaguuucugguauacuuca

 - 61

Get sequence
Deep sequencing13 reads, 7 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1