Stem-loop sequence cel-mir-2207

AccessionMI0010955 (change log)
DescriptionCaenorhabditis elegans miR-2207 stem-loop
Stem-loop
   --    a      a            a  u  g  gga   gg 
5'   ugug auugag cuguguauaaga ug aa ga   gag  g
     |||| |||||| |||||||||||| || || ||   |||   
3'   acac uaacuc gacacguauucu gc uu cu   cuu  c
   ac    g      g            -  -  g  aug   gc 
Get sequence
Deep sequencing
89 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11600300-11600383 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-2207
cel-mir-2207chrII: 11600300-11600383 [+]
cel-mir-8212chrII: 11603572-11603635 [+]
Database links

Mature sequence cel-miR-2207-5p

Accession MIMAT0011425
Previous IDscel-miR-2207
Sequence

1 - 

ugugaauugagacuguguauaag

 - 23

Get sequence
Deep sequencing78 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence cel-miR-2207-3p

Accession MIMAT0011426
Previous IDscel-miR-2207*
Sequence

63 - 

augcacaggcucaaugcacaca

 - 84

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1