Stem-loop sequence sme-mir-31b-3

AccessionMI0010954 (change log)
DescriptionSchmidtea mediterranea miR-31b-3 stem-loop
Gene family MIPF0000064; mir-31
Literature search

1 open access papers mention sme-mir-31b-3
(1 sentences)

Stem-loop
   -  a  c     g    c       a   acu 
5'  ca gg aagau cugg auagcug uaa   a
    || || ||||| |||| ||||||| |||    
3'  gu cc uucua gacu uaucgac auu   u
   a  a  u     g    -       c   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig27737: 5595-5658 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-31b-3
sme-mir-31b-2Contig27737: 4917-4980 [+]
sme-mir-31b-3Contig27737: 5595-5658 [+]
Database links

Mature sequence sme-miR-31b-5p

Accession MIMAT0003980
Previous IDssme-miR-31b
Sequence

3 - 

aggcaagaugcuggcauagcuga

 - 25

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

Mature sequence sme-miR-31b-3p

Accession MIMAT0013779
Previous IDssme-miR-31b*
Sequence

42 - 

agcuauucaggaucuuuccau

 - 62

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).