Stem-loop sequence sme-bantam-c-2

AccessionMI0010953 (change log)
DescriptionSchmidtea mediterranea bantam-c-2 stem-loop
Gene family MIPF0000153; bantam
Literature search

2 open access papers mention sme-bantam-c-2
(2 sentences)

Stem-loop
   -   uu            u               
5'  agu  aaaggcuuucau augauuuuaaaaug 
    |||  |||||||||||| ||||||||||||| u
3'  uca  uuuucgaaagua uacuagaguuuuau 
   g   -u            u               
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig483: 150256-150320 [+]
intergenic
Database links

Mature sequence sme-bantam-c-5p

Accession MIMAT0012086
Previous IDssme-bantam-c*
Sequence

7 - 

aaggcuuucauuaugauuuuaa

 - 28

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-bantam-c-3p

Accession MIMAT0003951
Previous IDssme-bantam-c
Sequence

39 - 

ugagaucauuaugaaagcuuuu

 - 60

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).