Stem-loop sequence sme-mir-754b-2

AccessionMI0010947 (change log)
DescriptionSchmidtea mediterranea miR-754b-2 stem-loop
Gene family MIPF0000749; mir-754
Stem-loop
   uuauca      - a c          gg    uu c      u 
5'       uccacc c g auguugcuug  ggua  a uauauu a
         |||||| | | ||||||||||  ||||  | ||||||  
3'       aggugg g c uauaacgaac  cuau  u auauaa u
   --uaua      a a -          ua    uu a      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig29676: 7130-7215 [-]
intergenic
Database links

Mature sequence sme-miR-754b-5p

Accession MIMAT0011236
Previous IDssme-miR-754b
Sequence

19 - 

guugcuuggggguauuacua

 - 38

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

Mature sequence sme-miR-754b-3p

Accession MIMAT0011415
Previous IDssme-miR-754b*
Sequence

52 - 

aauuuuaucaucaagcaauau

 - 72

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).