Stem-loop sequence sme-mir-2154-2

AccessionMI0010944 (change log)
DescriptionSchmidtea mediterranea miR-2154-2 stem-loop
Gene family MIPF0000781; mir-2154
Stem-loop
   -g      uauu     uuc          uu   a      a    aaau 
5'   agugau    agaau   agcuguacaa  ggc uugugu ugau    g
     ||||||    |||||   ||||||||||  ||| |||||| ||||     
3'   ucacua    uuuua   ucgauauguu  cug aacaca auua    a
   aa      --uu     uau          -u   -      -    caua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig21857: 11143-11240 [+]
intergenic
Database links

Mature sequence sme-miR-2154-5p

Accession MIMAT0011244
Previous IDssme-miR-2154
Sequence

18 - 

ucagcuguacaauuggcauugugu

 - 41

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

Mature sequence sme-miR-2154-3p

Accession MIMAT0011412
Previous IDssme-miR-2154*
Sequence

63 - 

acaagucuuuguauagcuuau

 - 83

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).