Stem-loop sequence sme-mir-124c-2

AccessionMI0010936 (change log)
DescriptionSchmidtea mediterranea miR-124c-2 stem-loop
Gene family MIPF0000021; mir-124
Literature search

1 open access papers mention sme-mir-124c-2
(6 sentences)

Stem-loop
        auauu    aa     a   c   u         a    au 
5' ccauu     caug  gcauu acc ugu gucuuagau guuu  u
   |||||     ||||  ||||| ||| ||| ||||||||| ||||   
3' gguaa     guac  cguaa ugg gca cggaauuua caaa  a
        --agu    --     g   c   -         -    ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig8879: 8243-8330 [+]
intergenic
Database links

Mature sequence sme-miR-124c-2-5p

Accession MIMAT0013778
Previous IDssme-miR-124c-2*
Sequence

17 - 

gcauuaacccuguugucuuagau

 - 39

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

Mature sequence sme-miR-124c-3p

Accession MIMAT0003995
Previous IDssme-miR-124c
Sequence

58 - 

uaaggcacgcggugaaugcca

 - 78

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).