Stem-loop sequence sbi-MIR529

AccessionMI0010924 (change log)
DescriptionSorghum bicolor miR529 stem-loop
Gene family MIPF0000388; MIR529
Literature search

2 open access papers mention sbi-MIR529
(9 sentences)

Stem-loop
                 a          ac   guaca       -  aucuc      cu uua 
5' gggagaagagagag guacagccuu  cau     cacacuc ca     aacagu  c   u
   |||||||||||||| ||||||||||  |||     ||||||| ||     ||||||  |    
3' ucuucuucucucuc caugucggaa  gua     gugugag gu     uugucg  g   a
                 c          --   -----       u  --cca      uc uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 44685716-44685831 [+]
intergenic
Database links

Mature sequence sbi-miR529

Accession MIMAT0011384
Sequence

96 - 

cuguacccucucucuucuuc

 - 115

Get sequence
Evidence not experimental

References

1
" Zhang L, Ware D Unpublished (2009).