Stem-loop sequence sbi-MIR437g

AccessionMI0010908 (change log)
DescriptionSorghum bicolor miR437g stem-loop
Gene family MIPF0000746; MIR437
Literature search

4 open access papers mention sbi-MIR437g
(6 sentences)

Stem-loop
   --c                              -       a au   c    g     gu      -aaaug     ucaagacauau 
5'    agucaaacuuuucuaacuuugacuaaguuu uagagaa u  guu acgu uacaa  ucaaau      cacua           u
      |||||||||||||||||||||||||||||| ||||||| |  ||| |||| |||||  ||||||      |||||            
3'    ucaguuugaagagauugaaacugguucaaa aucuuuu a  uag ugua auguu  aguuug      guggu           u
   gau                              u       a cg   u    g     gu      aucaaa     uuaagagauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 66620183-66620358 [-]
intergenic
Database links

Mature sequence sbi-miR437g

Accession MIMAT0011368
Sequence

154 - 

aaaguuagagaaguuugacuu

 - 174

Get sequence
Evidence by similarity; MI0001688

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).