Stem-loop sequence sbi-MIR399j

AccessionMI0010900 (change log)
DescriptionSorghum bicolor miR399j stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399j
(5 sentences)

Stem-loop
   ---  u           c     ugaa   c     ga  agcuu   a 
5'    ag gcgguucuccu uggca    cga ggcug  gc     gcc c
      || ||||||||||| |||||    ||| |||||  ||     |||  
3'    uc cguuaagagga accgu    guu ccggc  cg     cgg a
   ccg  c           a     --uc   c     ac  --gcu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 9784852-9784944 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR399j
sbi-MIR399kchr4: 9790202-9790264 [+]
sbi-MIR399jchr4: 9784852-9784944 [-]
Database links

Mature sequence sbi-miR399j

Accession MIMAT0011360
Sequence

71 - 

ugccaaaggagaauugcccug

 - 91

Get sequence
Evidence by similarity; MI0001802

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).