Stem-loop sequence sbi-MIR396d

AccessionMI0010897 (change log)
DescriptionSorghum bicolor miR396d stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention sbi-MIR396d
(13 sentences)

Stem-loop
   c    ca                g   u   uc   u  ucuu   uu 
5'  ucca  ggcuuucuugaacugu aac cga  gcg gc    agc  g
    ||||  |||||||||||||||| ||| |||  ||| ||    |||   
3'  aggu  cugaaagaacuuggua uug guu  cgc cg    ucg  c
   a    uc                g   u   -u   u  -cuc   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 68279979-68280074 [-]
intergenic
Database links

Mature sequence sbi-miR396d

Accession MIMAT0011357
Sequence

1 - 

cuccacaggcuuucuugaacug

 - 22

Get sequence
Evidence not experimental

References

1
" Zhang L, Ware D Unpublished (2009).