Stem-loop sequence sbi-MIR395l

AccessionMI0010896 (change log)
DescriptionSorghum bicolor miR395l stem-loop
Gene family MIPF0000016; MIR395
Literature search

4 open access papers mention sbi-MIR395l
(32 sentences)

Stem-loop
   --       u             ugga      -u   -u   g 
5'   guucccu caagcacuucaca    gcauua  uug  cuu g
     ||||||| |||||||||||||    ||||||  |||  ||| a
3'   caagggg guucgugaagugu    cguagu  aau  gaa g
   cu       -             --ua      uu   uc   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 4624021-4624104 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR395l
sbi-MIR395ichr7: 4623362-4623458 [+]
sbi-MIR395jchr7: 4623545-4623631 [+]
sbi-MIR395kchr7: 4623715-4623794 [+]
sbi-MIR395lchr7: 4624021-4624104 [+]
Database links

Mature sequence sbi-miR395l

Accession MIMAT0011356
Sequence

64 - 

gugaagugcuugggggaacuc

 - 84

Get sequence
Evidence by similarity; MI0001036

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).