Stem-loop sequence sbi-MIR395k

AccessionMI0010895 (change log)
DescriptionSorghum bicolor miR395k stem-loop
Gene family MIPF0000016; MIR395
Literature search

4 open access papers mention sbi-MIR395k
(30 sentences)

Stem-loop
   --     c                gaagcuucacauuggc 
5'   guucc uucaagcacuucacau                a
     ||||| ||||||||||||||||                g
3'   caagg agguuugugaagugua                a
   cu     -                accagaguucugaugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 4623715-4623794 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR395k
sbi-MIR395ichr7: 4623362-4623458 [+]
sbi-MIR395jchr7: 4623545-4623631 [+]
sbi-MIR395kchr7: 4623715-4623794 [+]
sbi-MIR395lchr7: 4624021-4624104 [+]
Database links

Mature sequence sbi-miR395k

Accession MIMAT0011355
Sequence

60 - 

gugaaguguuuggaggaacuc

 - 80

Get sequence
Evidence by similarity; MI0001033

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).