Stem-loop sequence sbi-MIR395j

AccessionMI0010894 (change log)
DescriptionSorghum bicolor miR395j stem-loop
Gene family MIPF0000016; MIR395
Literature search

4 open access papers mention sbi-MIR395j
(30 sentences)

Stem-loop
   --       u              gaag   uu   au      g 
5'   guucccu caagcacuucacau    cuc  ugc  uauauu g
     ||||||| ||||||||||||||    |||  |||  ||||||  
3'   caagggg guuugugaagugua    gag  acg  auguag c
   cu       -              acca   uu   --      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 4623545-4623631 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR395j
sbi-MIR395ichr7: 4623362-4623458 [+]
sbi-MIR395jchr7: 4623545-4623631 [+]
sbi-MIR395kchr7: 4623715-4623794 [+]
sbi-MIR395lchr7: 4624021-4624104 [+]
Database links

Mature sequence sbi-miR395j

Accession MIMAT0011354
Sequence

67 - 

gugaaguguuugggggaacuc

 - 87

Get sequence
Evidence by similarity; MI0005088

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).