Stem-loop sequence sbi-MIR319b

AccessionMI0010886 (change log)
DescriptionSorghum bicolor miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

5 open access papers mention sbi-MIR319b
(15 sentences)

Stem-loop
   --ga    u            cu   -       u         --ca      g   ac          ac         a   ug   aag 
5'     gagc cucuucagucca  cua aaauggc guagaguuu    uuagcu ccg  ucauccauuc  cuaccaaga cca  gac   c
       |||| ||||||||||||  ||| ||||||| |||||||||    |||||| |||  ||||||||||  ||||||||| |||  |||   g
3'     cucg gggaagucaggu  ggu uuugucg caucucgaa    aaucga ggc  ggugggugag  gaugguucu ggu  uug   a
   uucc    u            -u   a       -         cuaa      g   gc          cc         -   --   gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr3: 58355317-58355495 [-]
intergenic
Database links

Mature sequence sbi-miR319b

Accession MIMAT0011346
Sequence

158 - 

uuggacugaagggugcuccc

 - 177

Get sequence
Evidence by similarity; MI0001814

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).