Stem-loop sequence sbi-MIR172d

AccessionMI0010885 (change log)
DescriptionSorghum bicolor miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention sbi-MIR172d
(30 sentences)

Stem-loop
   ---u                a  ----a -  a g         aaa 
5'     ggcaucaucaagauuc ca     c cc u gauccaaau   c
       |||||||||||||||| ||     | || | |||||||||   c
3'     ucguaguaguucuaag gu     g gg a cuagguuua   a
   uacg                a  acgua a  - g         guc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sbi-miR172d

Accession MIMAT0011345
Sequence

68 - 

agaaucuugaugaugcugca

 - 87

Get sequence
Evidence by similarity; MI0001493

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).