Stem-loop sequence sbi-MIR169m

AccessionMI0010878 (change log)
DescriptionSorghum bicolor miR169m stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention sbi-MIR169m
(23 sentences)

Stem-loop
   ---          u    u       uccucucuaaaggaucagcaa 
5'    uagccaagga gacu gccuaua                     a
      |||||||||| |||| |||||||                     u
3'    aucgguuccu cuga cggguau                     a
   ccg          -    -       acucuggugaucuucggaguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 62252290-62252381 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR169m
sbi-MIR169nchr7: 62255445-62255537 [+]
sbi-MIR169mchr7: 62252290-62252381 [-]
sbi-MIR169lchr7: 62246903-62246999 [-]
Database links

Mature sequence sbi-miR169m

Accession MIMAT0011338
Sequence

1 - 

uagccaaggaugacuugccua

 - 21

Get sequence
Evidence by similarity; MI0001127

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).