Stem-loop sequence sbi-MIR169l

AccessionMI0010877 (change log)
DescriptionSorghum bicolor miR169l stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

5 open access papers mention sbi-MIR169l
(25 sentences)

Stem-loop
   uga          u    u       -u  -     gc      --au  g 
5'    uagccaagga gacu gccugug  cc uuugu  cgaagg    ca a
      |||||||||| |||| |||||||  || |||||  ||||||    ||  
3'    aucgguuccu cuga cggauac  gg agaua  guuucc    gu a
   -cg          -    -       uu  u     ga      gagu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is antisense to that predicted in [1], but is more conserved with the majority of the family (Zhang L, Ware D, pers. comm.).

Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 62246903-62246999 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR169l
sbi-MIR169nchr7: 62255445-62255537 [+]
sbi-MIR169mchr7: 62252290-62252381 [-]
sbi-MIR169lchr7: 62246903-62246999 [-]
Database links

Mature sequence sbi-miR169l

Accession MIMAT0011337
Sequence

4 - 

uagccaaggaugacuugccug

 - 24

Get sequence
Evidence by similarity; MI0001829

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).