Stem-loop sequence sbi-MIR169k

AccessionMI0010876 (change log)
DescriptionSorghum bicolor miR169k stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

4 open access papers mention sbi-MIR169k
(23 sentences)

Stem-loop
   --c          -            ccucaaauuug    g   u ua 
5'    agccaaggau gacuugccggcu           aagc ucg c  a
      |||||||||| ||||||||||||           |||| ||| |   
3'    ucgguuccug cugaacggcuga           uucg agu g  g
   aca          u            uucaaaaauaa    g   c uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 55762145-55762241 [-]
intergenic
Database links

Mature sequence sbi-miR169k

Accession MIMAT0011336
Sequence

1 - 

cagccaaggaugacuugccgg

 - 21

Get sequence
Evidence by similarity; MI0001826

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).