Stem-loop sequence sbi-MIR169h

AccessionMI0010874 (change log)
DescriptionSorghum bicolor miR169h stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention sbi-MIR169h
(24 sentences)

Stem-loop
   --          u   u      gcuauaugccugagagccugucucuu 
5'   uagccaagga gac ugccua                          g
     |||||||||| ||| ||||||                           
3'   aucgguuccu cug acggau                          g
   uc          u   u      auacgagucguguauguuuaaauggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sbi-miR169h

Accession MIMAT0011334
Sequence

1 - 

uagccaaggaugacuugccua

 - 21

Get sequence
Evidence by similarity; MI0001121

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).