Stem-loop sequence sbi-MIR164e

AccessionMI0010866 (change log)
DescriptionSorghum bicolor miR164e stem-loop
Gene family MIPF0000045; MIR164
Literature search

5 open access papers mention sbi-MIR164e
(13 sentences)

Stem-loop
   --------------------------------guuggagaagcagggcacgugcagagacacgccggccggagcac     c  c    aga         --   u    cu    ca 
5'                                                                             ggccg cg cgau   ucgaccucg  cac cgca  cgca  c
                                                                               ||||| || ||||   |||||||||  ||| ||||  ||||  c
3'                                                                             cuggc gc gcua   agcuggagu  gug gcgu  gcgu  a
   uaccaccucuuccccucgugcacgucacguccucgaucgcccacuucguuguucguucuccaaggagcgaucgaag     u  u    --g         ag   u    cu    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 44994962-44995166 [+]
intergenic
Database links

Mature sequence sbi-miR164e

Accession MIMAT0011326
Sequence

3 - 

uggagaagcagggcacgugca

 - 23

Get sequence
Evidence by similarity; MI0006503

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).