Stem-loop sequence sbi-MIR164d

AccessionMI0010865 (change log)
DescriptionSorghum bicolor miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

5 open access papers mention sbi-MIR164d
(13 sentences)

Stem-loop
   -        c           a   uccua   ucuc  gc   -c        cga      uc      c    u      g 
5'  uggagaag agggcacgugc ugc     acu    gc  gcu  cucuccgc   gaucca  guucau uaua cuccau g
    |||||||| ||||||||||| |||     |||    ||  |||  ||||||||   ||||||  |||||| |||| ||||||  
3'  accucuuc ucuugugcacg acg     uga    cg  cga  gagaggcg   cuaggu  caggua auau gaggua a
   u        c           c   ucaua   ---u  au   aa        ---      --      u    c      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 76208220-76208379 [-]
intergenic
Database links

Mature sequence sbi-miR164d

Accession MIMAT0011325
Sequence

1 - 

uggagaagcagggcacgugca

 - 21

Get sequence
Evidence by similarity; MI0001470

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).