Stem-loop sequence sbi-MIR160f

AccessionMI0010864 (change log)
DescriptionSorghum bicolor miR160f stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention sbi-MIR160f
(11 sentences)

Stem-loop
   ------------------------   c         g       u   a   aa   a      cg 
5'                         ugc uggcucccu aaugcca ccg gag  gca ugccau  u
                           ||| ||||||||| ||||||| ||| |||  ||| ||||||  g
3'                         acg acugaggga uugcggu ggc cuc  cgu gcggua  u
   cgacgacuccguuacguucguugg   u         g       u   c   --   -      cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 64834676-64834785 [-]
intergenic
Database links

Mature sequence sbi-miR160f

Accession MIMAT0011324
Sequence

1 - 

ugccuggcucccugaaugcca

 - 21

Get sequence
Evidence by similarity; MI0001101

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).