Stem-loop sequence sbi-MIR156h

AccessionMI0010862
DescriptionSorghum bicolor miR156h stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ---         -   -         a     gggc          cg     
5'    gugacagaa gag agugagcac cggcc    gugacggcac  guca 
      ||||||||| ||| ||||||||| |||||    ||||||||||  ||| a
3'    uacugucuu cuc ucacucgug gccgg    cgcugccgug  uagg 
   gcc         u   g         c     ----          --     
Get sequence
Deep sequencing
1386 reads, 876 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorbi1) Overlapping transcripts
chr_6: 50885046-50885139 [-]
intergenic
Database links

Mature sequence sbi-miR156h

Accession MIMAT0011322
Sequence

2 - 

ugacagaagagagugagcac

 - 21

Get sequence
Deep sequencing594 reads, 3 experiments
Evidence by similarity; MI0000657

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).