Stem-loop sequence dre-mir-196d

AccessionMI0010853 (change log)
DescriptionDanio rerio miR-196d stem-loop
Gene family MIPF0000031; mir-196
Literature search

8 open access papers mention dre-mir-196d
(27 sentences)

Stem-loop
   -a ug   u  gu     ua      u   cucua 
5'   g  auu ag  aguuu  uguugu ggg     u
     |  ||| ||  |||||  |||||| |||     u
3'   c  uaa uc  ucaaa  acaacg ccc     u
   uc gu   u  ug     gc      c   uauau 
Get sequence
Deep sequencing
12395 reads, 545 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 20913413-20913484 [+]
intergenic
Database links

Mature sequence dre-miR-196d

Accession MIMAT0011313
Sequence

8 - 

uagguaguuuuauguuguuggg

 - 29

Get sequence
Deep sequencing12366 reads, 11 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).