Stem-loop sequence dre-mir-2189

AccessionMI0010851 (change log)
DescriptionDanio rerio miR-2189 stem-loop
Literature search

1 open access papers mention dre-mir-2189
(6 sentences)

Stem-loop
   ugcacaguuuu  uccc    a       -              c        -u     
5'            ga    gccc aauugaa cacagcugaugcaa caaucaaa  uggu 
              ||    |||| ||||||| |||||||||||||| ||||||||  ||| a
3'            cu    cggg uugauuu gugucgacuauguu guuaguuu  auca 
   -------ccug  ucuu    a       u              u        uu     
Get sequence
Deep sequencing
6666 reads, 209 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
KN150127.1: 17150-17259 [+]
intergenic
Database links

Mature sequence dre-miR-2189

Accession MIMAT0011311
Sequence

67 - 

ugauuguuuguaucagcugugu

 - 88

Get sequence
Deep sequencing6653 reads, 11 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).