Stem-loop sequence dre-mir-222b

AccessionMI0010845 (change log)
DescriptionDanio rerio miR-222b stem-loop
Gene family MIPF0000051; mir-221
Literature search

7 open access papers mention dre-mir-222b
(59 sentences)

Stem-loop
   ---------     ga  ug a         c    -     -----ag    ug 
5'          gacgu  uc  c gacucagua ucgg uguag       ucug  u
            |||||  ||  | ||||||||| |||| |||||       ||||  g
3'          cugca  ag  g cugggucau aguc acauc       agac  a
   caucgcaca     -g  gu a         a    u     gacgaga    uu 
Get sequence
Deep sequencing
3104 reads, 155 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr21: 44568170-44568266 [-]
intergenic
Database links

Mature sequence dre-miR-222b

Accession MIMAT0011303
Sequence

55 - 

agcuacaucugaauacuggguca

 - 77

Get sequence
Deep sequencing3021 reads, 11 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).