Stem-loop sequence dre-mir-455-2

AccessionMI0010844 (change log)
Previous IDsdre-mir-455b
DescriptionDanio rerio miR-455b-2 stem-loop
Gene family MIPF0000129; mir-455
Literature search

1 open access papers mention dre-mir-455-2
(1 sentences)

Stem-loop
   auc    -----uu  c         g          u      a   u   gag 
5'    guug       cc ugaagugag guaugugccc uggacu cau gug   g
      ||||       || ||||||||| |||||||||| |||||| ||| |||    
3'    caac       gg acuucauuc cauauacggg accuga gua cac   c
   --a    uacaucc  u         a          u      c   c   gac 
Get sequence
Deep sequencing
6628 reads, 218 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 51776536-51776640 [+]
sense
ENSDART00000057304 ; col27a1a-201; intron 8
Database links

Mature sequence dre-miR-455-2-5p

Accession MIMAT0011302
Previous IDsdre-miR-455b
Sequence

23 - 

guaugugcccuuggacuacauu

 - 44

Get sequence
Deep sequencing3856 reads, 11 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

Mature sequence dre-miR-455-3p

Accession MIMAT0031993
Sequence

60 - 

augcaguccaugggcauauacac

 - 82

Get sequence
Deep sequencing5541 reads, 11 experiments
Evidence not experimental

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).