Stem-loop sequence dre-mir-107b

AccessionMI0010843 (change log)
DescriptionDanio rerio miR-107b stem-loop
Gene family MIPF0000024; mir-103
Literature search

5 open access papers mention dre-mir-107b
(11 sentences)

Stem-loop
   --    gc   u   --    u  c           c   -ua    
5'   ucug  cac cug  ggcu cu uacaguguugc uug   gcc 
     ||||  ||| |||  |||| || ||||||||||| |||   || u
3'   agac  gug gac  ucgg ga auguuacgacg aac   ugg 
   ca    au   c   uu    -  c           -   uag    
Get sequence
Deep sequencing
27054 reads, 991 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr17: 23573130-23573215 [+]
sense
OTTDART00000028572 ; pank1a-001; intron 5
ENSDART00000146787 ; pank1a-001; intron 5
ENSDART00000127583 ; pank1a-202; intron 5
ENSDART00000104724 ; pank1a-201; intron 5
KZ114956.1: 174798-174883 [+]
sense
OTTDART00000028572 ; pank1a-001; intron 5
ENSDART00000146787 ; pank1a-001; intron 5
ENSDART00000127583 ; pank1a-202; intron 5
ENSDART00000104724 ; pank1a-201; intron 5
KZ115525.1: 591133-591218 [+]
sense
OTTDART00000028572 ; pank1a-001; intron 5
ENSDART00000146787 ; pank1a-001; intron 5
ENSDART00000127583 ; pank1a-202; intron 5
ENSDART00000104724 ; pank1a-201; intron 5
Database links

Mature sequence dre-miR-107b

Accession MIMAT0011301
Sequence

51 - 

agcagcauuguacagggcuuu

 - 71

Get sequence
Deep sequencing27053 reads, 11 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).