Stem-loop sequence dre-mir-107b

Accession MI0010843
Description Danio rerio miR-107b stem-loop
Gene family MIPF0000024; mir-103
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--    gc   u   --    u  c           c   -ua    
  ucug  cac cug  ggcu cu uacaguguugc uug   gcc 
  ||||  ||| |||  |||| || ||||||||||| |||   || u
  agac  gug gac  ucgg ga auguuacgacg aac   ugg 
ca    au   c   uu    -  c           -   uag    
Get sequence
Genome context
Coordinates (Zv9) Overlapping transcripts
17: 23402957-23403042 [+]
sense
OTTDART00000028572 ; pank1a-001; intron 5
OTTDART00000028572 ; pank1a-001; intron 5
OTTDART00000028572 ; pank1a-001; intron 5
ENSDART00000127583 ; pank1a-202; intron 5
ENSDART00000146787 ; pank1a-001; intron 5
ENSDART00000104724 ; pank1a-201; intron 5
ENSDART00000127583 ; pank1a-202; intron 5
ENSDART00000146787 ; pank1a-001; intron 5
ENSDART00000104724 ; pank1a-201; intron 5
ENSDART00000127583 ; pank1a-202; intron 5
ENSDART00000146787 ; pank1a-001; intron 5
ENSDART00000104724 ; pank1a-201; intron 5
Database links

Mature sequence dre-miR-107b

Accession MIMAT0011301
Sequence

51 - 

agcagcauuguacagggcuuu

 - 71

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).