Stem-loop sequence dre-mir-2191

AccessionMI0010842 (change log)
DescriptionDanio rerio miR-2191 stem-loop
Literature search

1 open access papers mention dre-mir-2191
(1 sentences)

Stem-loop
   gugccu   --ucaa        ccu      u  u    a     gu  a      u 
5'       ugc      gggucuca   cugcca gg auug aggug  ag gagugu u
         |||      ||||||||   |||||| || |||| |||||  || ||||||  
3'       acg      cucagagu   gacggu cc uaac uccac  uc cuuaca g
   -----a   uccaaa        cau      c  -    a     ac  a      u 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 36790223-36790332 [+]
sense
OTTDART00000039497 ; march9-001; intron 1
ENSDART00000078240 ; march9-001; intron 1
Database links

Mature sequence dre-miR-2191

Accession MIMAT0011300
Sequence

68 - 

ucacaccuacaaucccuggca

 - 88

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).