Stem-loop sequence dre-mir-196c

AccessionMI0010840 (change log)
DescriptionDanio rerio miR-196c stem-loop
Gene family MIPF0000031; mir-196
Literature search

8 open access papers mention dre-mir-196c
(27 sentences)

Stem-loop
   -----------cccgucc     au        u         ga          g u a 
5'                   agcug  gcgugguu agguaguuu  uguuguuggg u g c
                     |||||  |||||||| |||||||||  |||||||||| | | u
3'                   uugac  ugcauuag uccgucaaa  acaacagcuc g c u
   ugccggaacuacuuccgu     --        u         ga          g u c 
Get sequence
Deep sequencing
13072 reads, 582 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr11: 2190621-2190730 [+]
sense
ENSDART00000018131 ; hnrnpa1a-201; intron 6
ENSDART00000082448 ; hnrnpa1a-202; intron 6
Database links

Mature sequence dre-miR-196c

Accession MIMAT0011298
Sequence

23 - 

uagguaguuugauguuguuggg

 - 44

Get sequence
Deep sequencing12300 reads, 11 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).