Stem-loop sequence dre-mir-2187

AccessionMI0010839 (change log)
DescriptionDanio rerio miR-2187 stem-loop
Gene family MIPF0001770; mir-2187
Literature search

1 open access papers mention dre-mir-2187
(1 sentences)

Stem-loop
   ---uc  a    a          uuua               --uuuag      
5'      ug auug ugauucuggc    auuaguauagccugu       ugauc 
        || |||| ||||||||||    |||||||||||||||       |||| a
3'      ac uaac auuaagaccg    uaaucguaucggaca       acuac 
   ggugu  g    g          uauc               uuucuua      
Get sequence
Deep sequencing
43 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr17: 19900754-19900857 [-]
sense
OTTDART00000055388 ; chrm3a-001; intron 2
ENSDART00000154251 ; chrm3a-001; intron 2
KZ115517.1: 190021-190124 [-]
sense
OTTDART00000055388 ; chrm3a-001; intron 2
ENSDART00000154251 ; chrm3a-001; intron 2
Database links

Mature sequence dre-miR-2187-5p

Accession MIMAT0011296
Previous IDsdre-miR-2187*
Sequence

22 - 

uuaauuaguauagccuguuuua

 - 43

Get sequence
Deep sequencing36 reads, 4 experiments
Evidence experimental; 454 [1]
Database links

Mature sequence dre-miR-2187-3p

Accession MIMAT0011297
Previous IDsdre-miR-2187
Sequence

61 - 

uuacaggcuaugcuaaucuaug

 - 82

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).