Stem-loop sequence dre-mir-1388

AccessionMI0010837 (change log)
DescriptionDanio rerio miR-1388 stem-loop
Gene family MIPF0000805; mir-1388
Literature search

3 open access papers mention dre-mir-1388
(6 sentences)

Stem-loop
   --uga  ga    -    gc    ca  a   u c         a  -  uga 
5'      ug  ugag cagu  uuuc  gg cug c aaccugaga ug cu   g
        ||  |||| ||||  ||||  || ||| | ||||||||| || ||    
3'      ac  gcuc guca  aaag  cc gac g uuggacucu ac gg   u
   ccgaa  uc    u    -a    ua  c   u c         a  u  uuu 
Get sequence
Deep sequencing
10069 reads, 545 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr23: 13604218-13604320 [+]
intergenic
KZ115670.1: 206316-206418 [+]
intergenic
Database links

Mature sequence dre-miR-1388-5p

Accession MIMAT0011292
Previous IDsdre-miR-1388*
Sequence

23 - 

aggacuguccaaccugagaaug

 - 44

Get sequence
Deep sequencing8066 reads, 9 experiments
Evidence experimental; 454 [1]
Database links

Mature sequence dre-miR-1388-3p

Accession MIMAT0011293
Previous IDsdre-miR-1388
Sequence

60 - 

aucucagguucgucagcccaug

 - 81

Get sequence
Deep sequencing2003 reads, 11 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).