Stem-loop sequence dre-mir-2184

AccessionMI0010834 (change log)
DescriptionDanio rerio miR-2184 stem-loop
Literature search

2 open access papers mention dre-mir-2184
(9 sentences)

Stem-loop
   -----------    au  u     aag     aac        uuu          guu 
5'            cuga  ga gcccu   cccua   aguaagag   augugcugag   a
              ||||  || |||||   |||||   ||||||||   ||||||||||    
3'            ggcu  cu uggga   gggau   ucauucuc   uacacgacuu   a
   uuacacugucc    au  u     aaa     -gu        ugu          aaa 
Get sequence
Deep sequencing
30324 reads, 1.81e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr10: 35654245-35654354 [-]
sense
ENSDART00000109345 ; ovca2-201; intron 1
Clustered miRNAs
< 10kb from dre-mir-2184
dre-mir-2184chr10: 35654245-35654354 [-]
dre-mir-132-2chr10: 35645017-35645135 [+]
dre-mir-212-2chr10: 35644706-35644798 [+]
Database links

Mature sequence dre-miR-2184

Accession MIMAT0011288
Sequence

23 - 

aacaguaagaguuuaugugcu

 - 43

Get sequence
Deep sequencing30104 reads, 11 experiments
Evidence experimental; 454 [1]
Database links
Predicted targets

References

1
PMID:19397817 "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA BMC Genomics. 10:195(2009).