Stem-loop sequence sme-mir-315

AccessionMI0010828 (change log)
DescriptionSchmidtea mediterranea miR-315 stem-loop
Gene family MIPF0000141; mir-315
Literature search

1 open access papers mention sme-mir-315
(1 sentences)

Stem-loop
   ----guu     ag    aua   u      u    cucu  g     a   aa 
5'        gagcg  gcuu   gaa uuugau guug    ga aguua uau  u
          |||||  ||||   ||| |||||| ||||    || ||||| |||  u
3'        uucgu  cgaa   cuu aaacua caac    cu ucaau gua  u
   gcuacug     ag    --a   u      c    -aau  g     a   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig20390: 2450-2553 [+]
intergenic
Database links

Mature sequence sme-miR-315-5p

Accession MIMAT0011282
Previous IDssme-miR-315
Sequence

21 - 

uuuugauuguugcucugagaguu

 - 43

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sme-miR-315-3p

Accession MIMAT0012167
Previous IDssme-miR-315*
Sequence

62 - 

acugucuaacaaccaucaaauu

 - 83

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).