Stem-loop sequence sme-mir-2172

AccessionMI0010815 (change log)
DescriptionSchmidtea mediterranea miR-2172 stem-loop
Stem-loop
   -----a    uuu    u    uu  -        a         gg   uu  u 
5'       auaa   ucca ugau  gg aaauaaug cuaugcaug  aca  ag a
         ||||   |||| ||||  || |||||||| |||||||||  |||  || g
3'       uauu   aggu acug  cc uuuauuau gauauguac  ugu  uc a
   agcgac    --u    u    -u  g        -         -a   --  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig2233: 53297-53396 [+]
intergenic
Database links

Mature sequence sme-miR-2172-5p

Accession MIMAT0012162
Sequence

20 - 

ggaaauaaugacuaugcaugggaca

 - 44

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sme-miR-2172-3p

Accession MIMAT0011272
Sequence

58 - 

uacauguauaguauuauuugccu

 - 80

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).