Stem-loop sequence sme-mir-2171

AccessionMI0010814 (change log)
DescriptionSchmidtea mediterranea miR-2171 stem-loop
Stem-loop
   ----gaaaac  aacag    -a   u     aa  c  --u       aug 
5'           gc     uaca  aug gaugg  au gc   auuucaa   c
             ||     ||||  ||| |||||  || ||   |||||||    
3'           cg     augu  uac uugcc  ug cg   uagaguu   u
   aaagauaaua  ---ga    ag   -     gg  a  uau       ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1252: 68837-68931 [-]
intergenic
Database links

Mature sequence sme-miR-2171

Accession MIMAT0011271
Sequence

21 - 

gugauggaaaucgcuauuuca

 - 41

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).