Stem-loop sequence sme-mir-2147c

AccessionMI0010813 (change log)
DescriptionSchmidtea mediterranea miR-2147c stem-loop
Gene family MIPF0000751; mir-2147
Stem-loop
   --uuguuuugcuguaa     gc    a  uc  u    c      cg 
5'                 uaacg  ggaa ac  gc cgug caucgu  u
                   |||||  |||| ||  || |||| ||||||  c
3'                 auugc  ccuu ug  cg gcac guagca  u
   acuccuuuuaacccua     ac    g  ga  -    u      cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig960: 86908-87003 [-]
intergenic
Database links

Mature sequence sme-miR-2147c

Accession MIMAT0011270
Sequence

21 - 

cggaaaacucgcucgugccaucgu

 - 44

Get sequence
Evidence experimental; 454 [1], Illumina [1]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).