Stem-loop sequence sme-mir-2169

AccessionMI0010808 (change log)
DescriptionSchmidtea mediterranea miR-2169 stem-loop
Stem-loop
   ----   uuuuu      ucu   a        au    u  g   uaa 
5'     gaa     uaucac   aac acuuugaa  ucga cu aua   a
       |||     ||||||   ||| ||||||||  |||| || |||    
3'     cuu     auagug   uug ugaaauuu  agcu ga uau   a
   ccug   --uuu      cuu   g        au    c  a   uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig573: 149096-149189 [+]
intergenic
Database links

Mature sequence sme-miR-2169-5p

Accession MIMAT0011267
Sequence

21 - 

aacuuugaaauucgaucugau

 - 41

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sme-miR-2169-3p

Accession MIMAT0012161
Sequence

52 - 

auaagcucgauauuuaaaguggu

 - 74

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).