Stem-loop sequence sme-mir-2168

AccessionMI0010807 (change log)
DescriptionSchmidtea mediterranea miR-2168 stem-loop
Stem-loop
   -----a         uuc    g  a          -      a        
5'       ugccagaaa   ugau cc uauucguuaa gguugu accagac 
         |||||||||   |||| || |||||||||| |||||| |||||| a
3'       augguuuuu   acug gg guaagcaguu ccaaca ugguuuc 
   uacuaa         ---    a  a          u      c        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig508: 30923-31016 [+]
intergenic
Database links

Mature sequence sme-miR-2168-5p

Accession MIMAT0011266
Sequence

21 - 

auauucguuaagguuguaac

 - 40

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2168-3p

Accession MIMAT0012160
Sequence

53 - 

ucacaaccuuugacgaaugag

 - 73

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).