Stem-loop sequence sme-mir-96a

AccessionMI0010803 (change log)
DescriptionSchmidtea mediterranea miR-96a stem-loop
Literature search

1 open access papers mention sme-mir-96a
(1 sentences)

Stem-loop
   ---cuucau      auauau        a   a  ga         agu uu   u 
5'          uugagu      cguuuggc cuu ag  auugucacu   g  cuu u
            ||||||      |||||||| ||| ||  |||||||||   |  |||  
3'          agcuca      gcgaacug gaa uc  uaacagugg   c  gaa u
   acuucgcuu      -acuuu        a   a  -a         --- uu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig10175: 11049-11156 [-]
intergenic
Database links

Mature sequence sme-miR-96a-5p

Accession MIMAT0011262
Previous IDssme-miR-96a
Sequence

21 - 

uuuggcacuuaaggaauugucacu

 - 44

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-96a-3p

Accession MIMAT0012159
Previous IDssme-miR-96a*
Sequence

66 - 

ugacaauacuaaagagucaagcg

 - 88

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).