Stem-loop sequence sme-mir-36c

AccessionMI0010802 (change log)
DescriptionSchmidtea mediterranea miR-36c stem-loop
Stem-loop
   aauuuca  -       -  c  -   u    caa     uu     cga   g 
5'        ac auaaauu ag ga uga uguc   cuggu  ggugu   guu a
          || ||||||| || || ||| ||||   |||||  |||||   |||  
3'        ug uauuuaa uc cu acu acag   ggcca  cuacg   uaa a
   cucuaac  c       a  u  u   u    aug     --     ---   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig3934: 37302-37403 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-36c
sme-mir-36cContig3934: 37302-37403 [+]
sme-mir-36aContig3934: 37835-37920 [+]
Database links

Mature sequence sme-miR-36c-5p

Accession MIMAT0012158
Previous IDssme-miR-36c*
Sequence

19 - 

cgaugauuguccaacugguuu

 - 39

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence sme-miR-36c-3p

Accession MIMAT0011261
Previous IDssme-miR-36c
Sequence

61 - 

ucaccggguagacauucauu

 - 80

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).