|
miRBase |
|
Stem-loop sequence sme-mir-36c |
||||||
| Accession | MI0010802 | |||||
| Description | Schmidtea mediterranea miR-36c stem-loop | |||||
| Stem-loop |
aauuuca - - c - u caa uu cga g ac auaaauu ag ga uga uguc cuggu ggugu guu a || ||||||| || || ||| |||| ||||| ||||| ||| ug uauuuaa uc cu acu acag ggcca cuacg uaa a cucuaac c a u u u aug -- --- a |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence sme-miR-36c-5p |
|
| Accession | MIMAT0012158 |
| Previous IDs | sme-miR-36c* |
| Sequence |
19 - cgaugauuguccaacugguuu - 39 |
| Evidence | experimental; Solexa [1-2] |
Mature sequence sme-miR-36c-3p |
|
| Accession | MIMAT0011261 |
| Previous IDs | sme-miR-36c |
| Sequence |
61 - ucaccggguagacauucauu - 80 |
| Evidence | experimental; 454 [1], Solexa [1-2] |
References |
|
| 1 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
| 2 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|