Stem-loop sequence sme-mir-2165

AccessionMI0010801 (change log)
DescriptionSchmidtea mediterranea miR-2165 stem-loop
Stem-loop
   --aaacuuuau     uc   uc      c          c    uguaaauuu u 
5'            augaa  cga  auucua aggaucgaau aguu         g a
              |||||  |||  |||||| |||||||||| ||||         |  
3'            uacuu  guu  ugagau ucuuagcuua ucaa         c a
   gcuccuuauuu     ua   ua      u          a    cuucucuau a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig15254: 539-650 [+]
intergenic
Database links

Mature sequence sme-miR-2165-5p

Accession MIMAT0012157
Sequence

20 - 

ucauucuacaggaucgaaucagu

 - 42

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2165-3p

Accession MIMAT0011260
Sequence

71 - 

uaauucgauucuuuagaguauu

 - 92

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).