Stem-loop sequence sme-mir-2164

AccessionMI0010800 (change log)
DescriptionSchmidtea mediterranea miR-2164 stem-loop
Stem-loop
   ----ccauau     ua   aa            -       -     u a 
5'           ucagg  aua  auuauauuugau ucacgua gagau g g
             |||||  |||  |||||||||||| ||||||| ||||| |  
3'           agucu  ugu  uaauaugaacua agugcgu uucua c a
   ucuacuucuc     --   aa            u       g     u u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig13809: 14673-14768 [+]
intergenic
Contig5497: 46058-46153 [-]
intergenic
Database links

Mature sequence sme-miR-2164-5p

Accession MIMAT0012156
Sequence

20 - 

uuauauuugauucacguagaga

 - 41

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence sme-miR-2164-3p

Accession MIMAT0011259
Sequence

54 - 

uugugcgugauaucaaguauaau

 - 76

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).