Stem-loop sequence sme-mir-2160-1

AccessionMI0010794 (change log)
DescriptionSchmidtea mediterranea miR-2160-1 stem-loop
Gene family MIPF0000769; mir-2160
Literature search

1 open access papers mention sme-mir-2160-1
(3 sentences)

Stem-loop
   -aaaauc        -uaaauau   g        u          guacua 
5'        uuugugau        ggc cuuaugug agaaccgguu      u
          ||||||||        ||| |||||||| ||||||||||       
3'        aaacacua        ccg gaauguac uuuuggucaa      a
   cuacuaa        ugauaaac   a        u          auuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig12997: 19613-19716 [+]
intergenic
Database links

Mature sequence sme-miR-2160-5p

Accession MIMAT0011254
Previous IDssme-miR-2160
Sequence

21 - 

uggcgcuuauguguagaaccgg

 - 42

Get sequence
Evidence experimental; Illumina [1-2], 454 [2]

Mature sequence sme-miR-2160-1-3p

Accession MIMAT0011416
Previous IDssme-miR-2160-1*
Sequence

65 - 

uuuuucauguaagagcccaaa

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).