|
miRBase |
|
Stem-loop sequence sme-mir-2158 |
||||||
| Accession | MI0010791 | |||||
| Description | Schmidtea mediterranea miR-2158 stem-loop | |||||
| Stem-loop |
- aa u -aau ug u a c a u gg aguaa uuu auuu aguauuuuu cgu uaccgaa ag uca c || ||||| ||| |||| ||||||||| ||| ||||||| || ||| cu uuauu aaa uaag ucauaagaa gca auggcuu uc agu g g gc u gagu gu - - - - u |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
Mature sequence sme-miR-2158-5p |
|
| Accession | MIMAT0011251 |
| Sequence |
21 - ugaguauuuuuucguauaccga - 42 |
| Evidence | experimental; 454 [1], Solexa [1-2] |
Mature sequence sme-miR-2158-3p |
|
| Accession | MIMAT0012149 |
| Sequence |
61 - ucgguaacgaagaauacuugga - 82 |
| Evidence | experimental; 454 [1], Solexa [1-2] |
References |
|
| 1 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
| 2 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|